DNA Jokes
![]()
Crick and Watson's discovery of the structure of DNA fifty years ago marked one of the great turning points in the history of science. Biology, immunology, medicine and genetics have all been radically transformed in the succeeding half-century, and the double helix has become an icon of our times. This collection of jokes offer some uniquely individual perspectives on DNA and its impact on modern science and society.
![]()
A programmer tracking a bug in the Unix kernel finally exclaims: "I can't believe how old this bug must be!"
His office mate replies: "Is it old enough to have dinosaur DNA in it?"
![]()
I've been single-stranded too long! Lonely ATGCATG would like to pair up with congenial TACGTAC.
Menage a trois! Ligand seeks two receptors into binding and mutual phosphorylation. Let's get together and transduce some signals.
Some dates have called me a promotor. Others have referred to me as a real operator. Personally, I think I'm just a cute piece of DNA who is still looking for that special transcription factor to help me unwind.
Highly sensitive, orally active small molecule seeks stable well-structured receptor who knows size isn't everything.
There must be a rational way to meet a date! I'm tired of hanging out in those molecular diversity bars, hoping to randomly bump into the right peptide. I want a molecule that will fit right into my active site and really turn me on. I'll send you my crystal structure if you send me yours!
Gene therapy graduate. After years of producing nothing but gibberish, I've shed my exons and am ready to express my introns. All I need is a cute vector to introduce me to the right host.
My RNA, I'm sorry I misread your UAAUAAUAA and inserted three tyrosines when you repeatedly asked me to stop. Something got lost in the translation. Please forgive me.
Naked DNA with sticky ends seeks kanamycin-resistant plasmid. EcoR1 sites preferred.
Uninhibited virus seeks reason to make me shed my coat protein.
This very selective oliogonucleotide has been probing for just the right target for long term hybridization.
Mature cell seeks same who still enjoys cycling and won't go apoptotic on me. Let's fight senescence together!
I'm a prolific progenitor with great potential for growth and self-renewal. Call me if you're a potent hematopoietic factor who still believes in endless nights of colony stimulation.
I don't always express myself on the surface, but I'm looking for a signal that you appreciate my complexity. Send me the right message that will penetrate my membranes, turn on my protein expression and release my potential energy.
![]()
DNA: A complex organic molecule characterized as the building block of life and appropriately shaped like a spiral staircase to nowhere.
![]()
Scientists have discovered intelligent DNA in some women. Unfortunatley
95% of them spat it out!
Thanks to Magic Marty
![]()
Why cremation is a good thing: Pravda reports that the head of the Communist Party in Moscow wants to clone Joseph Stalin.
![]()
Genetics and their impact on relations between the sexes
![]()
Mary had a little lamb, its fleece was slightly grey,
It didn't have a father, just some borrowed DNA.
It sort of had a mother, though the ovum was on loan,
It was not so much a lambkin, as a little lamby clone.
And soon it had a fellow clone, and soon it had some more,
They followed her to school one day, all cramming through the door.
It made the children laugh and sing, the teachers found it droll,
There were too many lamby clones, for Mary to control.
No other could control the sheep, since their programs didn't
vary,
So the scientists resolved it all, by simply cloning Mary.
But now they feel quite sheepish, those scientists unwary,
One problem solved, but what to do, with Mary, Mary, Mary!
![]()
If the DNA from the bloody glove were cloned and produced a
baby O.J. Simpson, then could we maybe get an actual guilty verdict?
![]()
Q:Do you know why redneck murder mysteries are so hard to solve?
A:The DNA is all the same and There are no dental record
![]()
Q. What does D.N.A. stand for?
A. National Association of Dyslexics.
![]()
The Associated Press' Washinton Bureau reported last week that American and English researchers had mapped the entire DNA of a Worm. They could have saved a lot of time and money if they had checked with the FBI LAB. Monica says that LAB already has the DNA of a worm on file.
![]()
The other day I met a good friend of mine who is a genetic engineer. He was happy to tell me of his job. His latest project is the splicing of DNA from different species of birds.
First he combined the DNA from a pheasant and a hen. It worked! He called it a "Phen."
Next he successfully combined a pheasant and a goose. He called it a "Phoose."
Yesterday, he explained, he finally was able to mix a pheasant and a duck. He called it... "Charlie."
![]()
The scientists in Scotland aren't telling the whole story about the sheep they cloned. It seems there was a mix-up in the lab when they were working with the DNA strand. Somehow they got the DNA backwards, and as a result the cloned sheep can only say "aaab aaab".
Dateline, National Institutes of Health, Feb. 1999:
Human Genome Project scientists announced a significant breakthrough in cracking the genetic code today. They disclosed that they have solved the long-standing problem of why only a small fraction of the DNA strand is actually used by the cell to code for proteins, while the rest seems to be just unused "junk".
The crux of the discovery was the amino acid sequence:
ATGCATGGACTGATCTAGTCATGCTGACTGGTACATACCGAATCAGTACCATGGACATATACAGTAC
GTTACCGTGACCTCAGTCAATGGCCATCTCGTGACTTCGATCTACTGAAATCCATGATCATAGCATG
ATCAGTCCTACGTAGCATGCAATGCATGCATATAGCATATCACATTATACGACTACGTACATGACGT
ACCGTAGTACATCAGG
which was found to decode to:
"this space intentionally left blank."
![]()
I got all excited, made a giant mess,
It was my misfortune, it landed on her dress.
Man I thought I was careful, and pointed far away,
But she caught a dressful of Flyin' D.N.A,
She was so damn playful, such a little tease,
I used to laugh at the rug burn, on her chubby knees.
She tried her best to escape it, but couldn't get away,
I bit my lip and fired, Flyin' D.N.A.,
I thought it was our secret, but she let it slip,
Monica went blabbin', right to Linda Tripp.
She taped it on her recorder, and she just pressed play,
And the world got an earful, of Flyin' D.N.A.,
When the dress gets tested, by the F.B.I.,
My only option is to just deny.
But before you impeach me, here's what's in store,
Your new El' Presedente', will be that putz Al Gore.
![]()
The FBI finally came back with the DNA results.
Clinton was a perfect match.
So was all of Arkansas.
![]()
For many years molecular biologists have been mystified by the fact that very
little of an organism's DNA seems to serve any useful function.
I have solved the mystery.
The reason why only 30% of human DNA performs any useful function is that the
rest of it is comments.
Once we decode a typical human genome, we see that the contents begin as follows:
===
/* HUMAN_DNA.H
*
* Human Genome
* Version 2.1
*
* (C) God
*/
/* Revision history:
*
* 0000-00-01 00:00 1.0 Adam.
* 0000-00-02 10:00 1.1 Eve.
* 0000-00-03 02:11 1.2 Added penis code to male version. A bit messy --
* will require a rewrite later on to make it neater.
* 0017-03-12 03:14 1.3 Added extra sex drive to male.h; took code from
* elephant-dna.c
* 0145-10-03 16:33 1.4 Removed tail.
* 1115-00-31 17:20 1.5 Shortened forearms, expanded brain case.
* 2091-08-20 13:56 1.6 Opposable thumbs added to hand() routine.
* 2501-04-09 14:04 1.7 Minor cosmetic improvements -- skin colour made
* darker to match my own image.
* 2909-07-12 02:21 1.8 Dentition inadequate; added extra 'wisdom' teeth.
* Must remember to make mouth bigger to compensate.
* 4501-12-31 14:18 1.9 Increase average height.
* 5533-02-12 17:09 2.0 Added gay option, triggered by high population
* density, to try and slow the overpopulation problem.
* 6004-11-04 16:11 2.1 Made forefinger narrower to fit hole in centre of
* CD.
*/
/* Standard definitions
*/
#define SEX male
#define HEIGHT 1.84
#define MASS 68
#define RACE caucasian
/* Include inherited traits from parent DNA files.
*
* Files must be pre-processed with MENDEL program to provide proper
* inheritance features.
*/
#include "mother.h"
#include "father.h"
#infndef FATHER
#warn("Father unknown -- guessing\n")
#include "bastard.h"
#endif
/* Set up sex-specific functions and variables
*/
#include <sex.h>
/* Kludged code -- I'll re-design this lot and re-write it as a proper
* library sometime soon.
*/
struct genitals
{
#ifdef MALE
Penis *jt;
#endif
/* G_spot *g; Removed for debugging purposes */
#ifdef FEMALE
Vagina *p;
#endif
}
/* Initialization bootstrap routine -- called before DNA duplication.
* Allocates buffers and sets up protein file pointers
*/
DNA *zygote_initialize(Sperm *, Ovum *);
/* MAIN INITIALIZATION CODE
*
* Returns structures containing pre-processed phenotypes for the organism
* to display at birth.
*
* Will be improved later to make output less ugly.
*/
Characteristic *lookup_phenotype(Identifier *i);
===
...and so on.
[ Note that God uses three-space tabs ]
--
The original author of this joke is Mathew Murphy.
![]()
"I have good news and bad news," a defense attorney
told his client.
"First the bad news: The blood test came back, and your DNA is an exact
match with the sample found on the victim's dress."
"Oh, no - I'm ruined!" cried the client. "What's the good news?"
"Your cholesterol is down to 140!"
![]()
More about 50 years of DNA:
Double
helix: 50 years of DNA
50
Years of DNA
New
York Times on 'A Revolution at 50'
![]()